1. Search Result
Search Result
Results for "

Tau ASO-12 (murine) (sodium)

" in MedChemExpress (MCE) Product Catalog:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-132582A

    Tau Protein
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    <em>Tau</em> <em>ASO-12</em> (<em>murine</em>) (<em>sodium</em>)

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: